JavaScript seems to be disabled in your browser. For the best experience on our site, be sure to turn on Javascript in your browser.
Tel: +1-832-696-8203
Email: [email protected]
Worldwide Distributors
In vitro transcription of capped mRNA with modified nucleotides and Poly(A) tail
TSA (Tyramide Signal Amplification), used for signal amplification of ISH, IHC and IC etc.
Separation of phosphorylated and non-phosphorylated proteins without phospho-specific antibody
A convenient and sensitive way for cell proliferation assay and cytotoxicity assay
Protect the integrity of proteins from multiple proteases and phosphatases for different applications.
SP6 RNA Polymerase is a HIGHLY SPECIFIC DNA-dependent 5' →3' RNA polymerase that recognizes SP6 promoter sequences. SP6 RNA polymerase can catalyze the incorporation of NTP downstream of single- or double-stranded DNA SP6 promoters to synthesize RNA that is complementary to the template DNA downstream of the SP6 promoter. The SP6 promoter sequence is ATTTAGGTGACACTATAGAA, where the last G is the first base of transcription.
The RNA synthesized by SP6 RNA Polymerase can be used for hybridization probes, genomic DNA sequence analysis, RNase protection assays, antisense RNA synthesis, RNA templates for in vitro translation, substrates for RNA splicing studies, RNA secondary structure and RNA-protein interactions, nucleic acid amplification analysis, siRNA, miRNA and other small RNAs.
Store at -20 °C.